Home / Expert Answers / Biology / can-someone-please-help-me-with-these-questions-and-also-explain-the-answer-for-1-most-sequencin-pa819

(Solved): Can someone please help me with these questions and also explain the answer for 1. Most sequencin ...



Can someone please help me with these questions and also explain the answer for 1.

Most sequencing method require the amplification of target DNA. Which of the following primer pairs would be the most approprYou are planning a Next Generation Sequencing (NGS) experiment to study the mechanism of tumorigenesis. Formation of tumor co

Most sequencing method require the amplification of target DNA. Which of the following primer pairs would be the most appropriate to amplify this sequence for sequencing? GCAGGAGTTTCAAACTTTACGACACATAATAAAAGTAGTAAATAATAATGACAGTATCTCAAATCAG TGCAGGGGGGAAAGGCCTACTAATACCTTACCACCCTAGAAAGGCATGATGAAAATTTAAGATAGA AGGAAAATATAAATTGAAAAAAAAAAACCTAAATATTCTAAGAAAAAAGGAATCTAGTTTGTCAAAA TGTGACTTGAATTAATAGATAAGGAGAGTCACTTAACAAATGATTCTGACAAATATCTTCTCTTTCCA GGGAGAATCACTGAGCCAGAATAAAATTGAACAGATGATAAGAGGGTCAAAATTATGTTTATCTTA GGAAAAGTAGAATAGAAAATTTATAAGCAGATTAAAATTTTCCCAACATTCTTGTGAAATATGACA CATCCCAATCTTAACAGATGTGATGGTGGGATAATTGGATAGCAATATGGGAAAAGATATATTTAAT TTCCGTTGCTACACCAAATGCCATCATTTGGGATACTGTACTTGTGAGTGGAAGTGTGGTACTATTTC ACCAAATGCCA A B C You are planning a Next Generation Sequencing (NGS) experiment to study the mechanism of tumorigenesis. Formation of tumor could happen due to overexpression of an oncogene, translocation leading to a fusion gene or reduced expression of tumor suppressor gene. Which of the following order of NGS experiments would be most appropriate? A. WGS--MethylSeq--RNASeq--CLiPSeq B. MethylSeq-WES-RNASeq-CLiPSeq C. WES-- MethylSeq-RNASeq-CliPSeq D. RNASeq-WES-MethylSeq--CliPSeq


We have an Answer from Expert

View Expert Answer

Expert Answer


We have an Answer from Expert

Buy This Answer $5

Place Order

We Provide Services Across The Globe